Skip to main content

Table 1 Reference genes and their primer sequences that were selected for evaluation of expression stability during flower development in cotton (Gossypium hirsutum) for qPCR analysis, as the sequence of two genes of interest MADS-box.

From: Identification and evaluation of new reference genes in Gossypium hirsutumfor accurate normalization of real-time quantitative RT-PCR data

Gene abbreviation Acession A. thaliana ortholog locus A. thaliana annotation Similarity (e-value) Identity (%) Gene Size ** Blast alignment Primer sequence
GhACT4 AY305726 At5g09810 Actin gene family 6.90E-194 86% 1700 1013 TTGCAGACCGTATGAGCAAG/ATCCTCCGATCCAGACACTG
GhEF1α 5 DQ174254 At5g60390 Elongation Factor 1-alpha 5.30E-225 85% 1764 1193 TCCCCATCTCTGGTTTTGAG/CTTGGGCTCATTGATCTGGT
*GhFBX6 DR463903 At5g15710 F-box family protein 2.30E-93 79% 1884 567 TGCCTGCAGTAAATCTGTGC/GGGTGAAAGGGTTTCCAAAT
*GhPP2A1 DT545658 At1g59830 Catalytic subunit of protein phosphatase 2A 3.30E-110 77% 1301 675 GATCCTTGTGGAGGAGTGGA/GCGAAACAGTTCGACGAGAT
*GhMZA DT571956 At5g46630 Clathrin adaptor complexes medium subunit family protein 1.40E-131 82% 1853 755 CCGTCAGACAGATTGGAGGT/AAAGCAACAGCCTCAACGAC
*GhPTB DT574577 At3g01150 Polypyrimidine tract-binding protein homolog 1.50E-120 77% 1511 752 GGTTACCATTGAGGGTGTGG/GTGCACAAAACCAAATGCAG
*GhGAPC2 ES810306 At1g13440 Glyceraldehyde-3-phosphate dehydrogenase C-2 0.0 83% 1439 858 TCCCCATCTCTGGTTTTGAG/AACCCCATTCGTTGTCCATA
GhβTUB3 AY345606 At5g12250 Beta-tubulin 5.70E-198 80% 1696 1135 GATTCCCTTCCCTCGTCTTC/CGGTTAGAGCTCGGTACTGC
***GhUBQ14 DW505546 At4g02890 Polyubiquitin 0.0 80% 1502 510 CAACGCTCCATCTTGTCCTT/TGATCGTCTTTCCCGTAAGC
GhMADS3 ES812912 At4G18960 AGAMOUS NA NA NA NA ATCAAGCGGATCGAAAACAC/CAACCTCAGCGTCACAAAGA
GhSEP-like1 ES827315 At1G24260 SEPALLATA3 NA NA NA NA TCCGTTCTTTGTGATGCAGA/CCATGGCTGCACTTCTGGTA
  1. *All cotton sequences were named according the most similar ortholog locus (GhFBX6, GhPP2A1, GhMZA, GhPTB and GhGAPC2 from Arabidopsis thaliana) (GhACT4, GhEF1α5 and GhβTUB3 from Gossypium hirsutum.**Size in base pair (pb) of the coding sequence of the ortholog locus in A. thaliana. ***Cotton gene previously used as reference gene in qPCR [26]. NA - not applicable.