Skip to main content

Table 1 PCR primers used in this study

From: Non-redundant functions of two proline dehydrogenase isoforms in Arabidopsis

Name1 Sequence (5'->3') Used for
Pdh1-LP1 (A) tctcctctatcccaacctctg pdh1-1, GABI_308F08 (pdh1-3), SALK_119334 (pdh1-4)
Pdh1-RP1 (B) gatcgctcactcgtttcagaag  
Pdh1-LP2 (C) aagttggtgagaggggcttac SALK_081276 (pdh1-2)
Pdh1-NS-r (D) cgcaatcccggcgattaatctc ProDH1 cloning
Pdh1-f caccataATGgcaacccgtcttctc2  
Pdh2-LP gtaaccagcccctaaacctc SALK_108179, GABI_918D08, SAIL_90_G05
Pdh2-RP ggagtactagatcgcgtgtaac  
Pdh2-LP2 (F) aaaccctaccttcgtctcac GT1788 (pdh2-1), GABI_328G05 (pdh2-2)
Pdh2-RP2 (G) cactaacccgttttaggacattc  
Pdh2-LP3 gagaagagttatggcttggtg GABI_187C05
Pdh2-RP3 atgtccctttgtaatctgaattgg  
Pdh2-f (E) caccataATGgcaaaccgtttcctc2 ProDH2 cloning
Pdh2-NSr ccaagccataactcttctcttaag  
Pdh2-Prom-f catttggatccttaccatccac ProDH2 promoter cloning
Pdh2-Prom-r cgggatccgtttgcCATttaaactc2  
Salk_LBb2 ttcggaaccaccatcaaacag SALK lines
Gabi-LB cccatttggacgtgaatgtagacac GABI lines
Sail-LB2 gcttcctattatatcttcccaaattaccaataca SAIL_90_G05
Gus5'rev atttcacgggttggggtttc GT1788
Put1KO-f aaacatcgctacatagtaataacactaacgcacgcta
gaaCGGATCCCCGGGTTAATTAA3
Put1 knockout
Put1KO-r ttggtttgtctttgaaattggagtatatattatagtcctcG
AATTCGAGCTCGTTTAAAC3
 
SDH-f caccacgagaataaagATGctatcgct2 SDH-MTP
SDH-Pdh1-r cttgttgtccaaaggagagCTCGTGATCTATTATGTG4 SDH-MTP ProDH1 fusion
SDH-Pdh2-r ggttggtcaaaggaaaggatCTCGTGATCTATTATGTG4 SDH-MTP ProDH2-fusion
Put1-f caccctagaaATGatagcttcc2 Put1 cloning
Put1-r taggcctactctttttggaatc  
Pdh1-pr-r atggtcataaaacgtacttttcac northern probes
(with Pdh1-f or Pdh2-f)
Pdh2-pr-r gactcatacacgctactcac  
P5CS1-f aatgagaggaaaaggacaag P5CS1 probe
[8]
P5CS1-r gataggatatgagtactaagcagag  
P5CDH-f tggacagaagtgttctgcac P5CDH probe
P5CDH-r gcttccaacactagaggaag  
  1. 1 Letters in brackets refer to the abbreviations in Figure 6; 2 capital letters indicate the translation start codon; 3 capital letters indicate the nucleotides specific for the resistance cassette, lower case letters correspond to Put1 5' and 3' sequences; 4 capital letters correspond to the 3' sequence of the SDH-MTP, lower case letters correspond to the nucleotides encoding the N-terminus of the predicted mature Arabidopsis ProDH proteins.