Skip to main content

Table 2 Primers used for RT-PCR and BAC screening

From: Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

Gene Forward primer Reverse primer Clone ID GenBank No.
UBQ ACA TTC AGA AGG AGT CAA CCC CGATGTCGATTTCGATTTCC   
OnDRRP TGAAAAAGAAACCCATCTGCA GCCCATAGGTGCCAATATTT P-5-O-22 HQ832781
OnExpansin ACGCAACTTTCTATGGCGG AAGCAACCACAGCTCCAAGT O-1-O-24 HQ832782
OnTI1 ATCACTTTGGCTCTGCTGCTT TGCCGAGGTCCTCGACTTCCA J-1-K-16 HQ832783
OnTI2 AAGAAGAACTCCCCACAAGAA AGGTTGATCGATCGAAGCA J-1-K-16 HQ832783
OnTI3 ATCACTTTGGCTCTGCTGCTT AGCAATGAATGACGATCGAC J-1-K-16 HQ832783
OMADS3 GAGGTATCAGCAAGTTACCG CGAACGATCTTAATCGACTC 45-3-B-1 HQ832787
OMADS6 AAACCCAGAGTAGTCAGCAG GTCATATCCCATTGCATGA 73-1-K-8 HQ832788
OMADS8 ATGGAAGGCAGCATGAGAGAAC AAAGCGTTAGCATTGTTACTTGTTT AAP-1-C-19 HQ832789
OMADS9 GATAAACCAAAACCTGAGGA TTTTGTAGGTATCGGTCTGG L-1-P-13 HQ832790
OnFT ATTGTAGGACGAGTGATTGG TACTTGGACTTGGAGCATCT Q-1-I-4 HQ832784
OnLeafy TTCCTGGATCTCAACATCAT TGCTGAAATCCTCAAACTTCA Orp-2-F-21 HQ832785
OnTFL TTGTAGTTGGTAGAGTTATAGGAGAAG ATCAGTCATAATCAGTGTGAAGAAAG Q-1-B-10 HQ832786