Skip to main content

Table 5 Primers used in the promoter study.

From: Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

Gene Prom. size Forward primer Reverse primer
OnTI1 1913 AAAAAGCAGGCTGTCGACAAAGCCCAATTCATTCCAGT AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA
  1340 AAAAAGCAGGCTTTCATGTTAACAACCATC AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA
  920 AAAAAGCAGGCTCAACTTCATTTACTGTAGCTC AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA
  740 AAAAAGCAGGCTTGAAAAATTGTGAG AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA
  360 AAAAAGCAGGCTCGGAACTCCACAAG AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA
OnExpansin 1027 AAAAAGCAGGCTGCCCCAAATGACACCTTA AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG
  882 AAAAAGCAGGCTCTCCTATTGCACCCATTTTC AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG
  746 AAAAAGCAGGCTTGATTCAACCCATTC AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG
  569 AAAAAGCAGGCTTGCACAGAGGCAAACATATATTT AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG
  334 AAAAAGCAGGCTCAACGCAAGTTAACC AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG
  133 AAAAAGCAGGCTCAGCATGTGCACTTCCACCT AGAAAGCTGGGTCATTGTTAGAGTTAGAATTTG
OnTI2 1151 AAAAAGCAGGCTAAACAAGCTTCTCCCCCTTTGT AGAAAGCTGGGTCATCTTAATAATTAGCTTGTTG
OnDRRP 1024 AAA AAG CAG GCT AGG AAG GAC ACA CAA CTT AGA AAG CTG GGT CAT TAG AGA GTA GGA GGT