Figure 10From: Divergent patterns of endogenous small RNA populations from seed and vegetative tissues of Glycine maxStem loop secondary structures of gma-miR390 and gma-miR828 RNA precursors. The miR390 targets the TAS3 gene and miR828 targets the TAS4 gene in Arabidopsis. The miR390b-3p (CGCTATCTATCTTGAGCTTCA) found in our smRNA collection differs with respect to that entered in miRBase with Accession number MIMAT0020935.Back to article page