Identification of wild soybean miRNAs and their target genes responsive to aluminum stress

Zeng, Qiao-Ying; Yang, Cun-Yi; Ma, Qi-Bin; Li, Xiu-Ping; Dong, Wen-Wen; Nian, Hai

doi:10.1186/1471-2229-12-182

BMC Plant Biology

Table 2 Identification of novel microRNAs in wild soybean

From: Identification of wild soybean miRNAs and their target genes responsive to aluminum stress

miR_name^a	Sequenced sequence	Length	genome ID	strand	dG	CG%	MFEI	raw_Al-free	raw_Al-treated	Glycine maxGenome^b	Glycine sojaGenome^c
PC^d-1-5p	TGGCCTGTGATGCATCAATTTGTC	24	Gm12	+	−26.6	44	0.7	49	10	yes	no
PC-1-3p	GTCTCTGATGAATGCTCAAATTCT	24	Gm12	+	−26.6	44	0.7	7	11	yes	no
PC-4-5p	GTCGTTGTAGTATAGTGGTAAGT	23	Gm05	+	−33.5	37.3	0.7	26	8	yes	yes
PC-4-3p	GTCGTTGTAGTATAGTGGTAAGTA	24	Gm05	+	−33.5	37.3	0.7	84	48	yes	yes
PC-8-5p	ATTGTTGAGACGATTCTGTAGACG	24	Gm09	+	−16.8	28.3	0.6	12	9	yes	no
PC-12-5p	AAATCTACATGCGGATCAAGTTGA	24	Gm17	+	−34.2	39.7	1.1	0	12	yes	yes
PC-20-3p	CAACGGTCATAATGTAGATTTA	22	Gm05	+	−29	40.6	0.7	10	16	yes	yes
PC-21-5p	CAAAGATTCATCGTAGGCTAGACT	24	Gm08	+	−25.1	55.4	0.7	14	12	yes	yes
PC-25-3p	CTACATAAGGCACGAGATCATC	22	Gm18	-	−17	38.2	0.7	7	29	yes	yes
PC-26-3p	CATCGGTCGAGAGCGTTCTT	20	Gm06	-	−48.8	46.2	0.9	14	6	yes	no
PC-28-3p	CATTTGGGCACCTATTTTGACTC	23	Gm06	+	−18.8	40	0.8	24	2	yes	yes
PC-32-3p	TATATTCGGATATTCACATT	20	Gm02	+	−26.7	34.3	0.8	15	10	yes	no
PC-33-3p	GGAGAACAAAGAAGCAGCTAAATTC	25	Gm16	+	−22.4	32.6	0.7	4	29	yes	no
PC-35-5p	AAAAGGACACATGACTCACACCTA	24	Gm10	-	−11.9	31.2	0.5	10	10	yes	yes
PC-36-5p	GAGTTGGCGAGTTGGACACGTGGC	24	Gm08	-	−38	59.5	0.8	9	12	yes	no
PC-39-5p	TAGATTTTAAAGTTGCGGATCA	22	Gm04	-	−42.3	38.5	1.1	10	32	yes	yes
PC-40-3p	AATACGTAAGGCTTGAGCTTGACT	24	Gm01	-	−37.8	42.9	1	8	17	yes	yes
PC-41-3p	AAATCAGATGATATGGACTTAAAT	24	Gm13	-	−21.2	28.3	0.8	19	20	yes	yes
PC-42-5p	AAGAAACGTTGACTCTCCGTGTT	23	Gm03	-	−39.9	38.5	0.8	11	5	yes	no
PC-43-5p	ATCGGGATGCTCAGTTCGCATGGT	24	Gm10	+	−33.9	46.6	1	5	11	yes	yes
PC-44-3p	ATGAACCCTTTGAGATCACTGGTT	24	Gm06	-	−26.2	47.1	0.7	17	13	yes	yes
PC-45-5p	AGACGGTAAGAAGAGAATTTCAAT	24	Gm01	-	−14.3	23.8	0.8	11	4	yes	yes
PC-46-5p	CTATATGATGAAGATA	16	Gm18	+	−28.3	34	0.9	52	26	yes	yes
PC-47-3p	CGTTGTAGTATAGTGGTAAGTATT	24	Gm19	+	−31.1	46	0.5	9	11	yes	yes
PC-48-3p	TTAGCTTCTTTCACCTTTCCC	21	Gm17	-	−41.8	41.5	1.2	135	137	yes	no
PC-52-5p	TGAGGGCAAAGATATTAGAGAA	22	Gm05	-	−26	35.9	0.7	5	12	yes	yes
PC-56-3p	GGCGAGGAATCTGGGCTCATT	21	Gm15	+	−37.5	47.6	1	16	19	yes	yes
PC-57-3p	GCATACAGGGAGTCAAGCAGA	21	Gm09	-	−48	43	1.2	20	27	yes	no
PC-58-5p	TTAGTTGAATGGTACTGTAGTAGT	24	Gm06	+	−29.2	37	0.7	6	11	yes	yes
PC-60-3p	TTTCCCGGCAATGGAACCA	19	Gm17	+	−19.3	38	0.5	298	208	yes	no
PC-61-5p	AACTTACTGACTCGTTGACTCGGT	24	Gm14	+	−21.1	39.4	0.8	10	5	yes	yes

Genomic locations of the pre-miRNA are based on the Glycine max assembly Gmax_109_repeatmasked.fa downloaded from ftp.plantgdb.org/download/Genomes/GmGDB/. Identification of known miRNAs was based on miRBase 18.0.
a, miR_name is the name that was assigned to the detected miRNA sequences.
b, G. max Genome is the precursor sequences whether they could be mapped to Glycine max [56].
c, G. soja Genome is the precursor sequences whether they could be mapped to Glycine soja EST or GSS [92].
d, PC means 'predicted candidate'.

Back to article page

ISSN: 1471-2229

Contact us

General enquiries: journalsubmissions@springernature.com