Skip to main content

Table 2 Primer sets for B-, C-, D- and γ-hordein transcripts and reference genes

From: Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

Name Primer sequence forward Primer sequence reverse
Common B TTTCCAACAACCTCAACCACA GTAGGGTACGCAGCGCAAT
B1 GCAAGAACAACCCCAACAGTC GTAGGGTACGCAGCGCAAT
B1a CCAGCAACTGCCGCAAATCT CAACTGTTGTTGGGTTTGGGAT
DQ148297 CCACTCCAGCTAGCTCAC TGCCGAATGGAAGTATGCG
X87232 GGGCTACAACAACCAATTCTG CCTTGTGGGAGTGGTGTTG
JQ867084 CCAACAGTCGGTCCAAGGA CATTGTCCAACTTTCTCCTGC
B2 CCGCAGCAAGTCGGACAA CCTGTTGTTGTTGACCAAC
B3 GTGCAATCGTCTACTCTATCG GGGAGACACCTTGGACCAAT
B3a CTATCGTCCTGCGAGAACAAT CCGACTTGTTGCTGTTGTG
B3b ACGTATTGCAAGGTCGCAG CGGCAGTTGTTGGCAACAC
B3c AAACAACAGCAAGTGCCACAT TCGCCTCAAGCTGAGCTAG
DQ826387 CCTCAACCACAACAAGTTGGC CTGTACGACGGCACATTAACAC
GQ342976 CTCCTACAAGAACAACAAGAC CCTTGCATGGGTTTAGCTGC
JQ867088 AACAACAGTCGCAGCTACAT TTCAAGCTGAGCTAGCTGGA
Common C TAATTCCCCAGCAACCTCAA CCATACTCCAGATGGTTTGTTG
C1 TCAACCAGTCCCCCAGCA CTTGTTGGGGTTGCGGTT
S66938 CCTCAACAACCATTTCCCCT AAATGGTTGTTGTGGTTGCCA
Common D CACCGTGTCTCTGCACCATG TGCCGTAGTACAACTCGTTGG
Common γ1 CAACCGCAACAACTAGCTCA CACCAACAAATGGTGCTTTG
AJ580585 CCAACAACAACTGAATCCGTA TTGCAGGCAACATTGTTGCA
X13508 CCTGTGTCATTGTTATCGTACA CGACAACTGCTCTGTTGCAC
Common γ3 GGTTGGGTCATTGGTGATTC AGCAATAAGGTGGGACATGC
X72628 AGCAAATATCAATGAGCAG GAGATTGGACAAAACCATGAC
JQ867080 AGCAAATATCAATGAGCAA GAGATTGGACAAAACCATGAT
Actin CCTCAGTTGAGAAGAGCTACG TCTGCGCCAATCGTGATC
Ubiquitin TCAAGGTGAAGACACTTACTGG CATAGATGAGCCTCTGTTGAAC
PTF CTATGTGCATGTGCGTGTC CTTGAGAATCTTGTTGTAGCTG