Skip to main content

Table 1 Genes and primer sets used for real time RT-PCR

From: An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development

Gene abbreviation GenBank Accession Arabidopsis ortholog locus Arabidopsis locus description Primer pair (forward/reverse) Product size bp/efficiency*
Actin EC969944 AT5G09810.1 Actin 7 (ACT7)/actin 2 (other hits include ACT1, ACT3, ACT4, ACT8, ACT11, ACT12) CTTGCATCCCTCAGCACCTT/TCCTGTGGACAATGGATGGA 82/2.00
AP47 EC951857 AT5G46630.1 Clathrin adaptor complexes medium subunit family protein GGTTCCCATGTTTACAGCATCTG/GCACCCACTCAACGGTATTGTAC 86/1.93
Aquaporin EC969993 AT2G37170.1 Plasma membrane intrinsic protein 2B (PIP2B)/aquaporin PIP2.2 (PIP2.2) TCCGCCAAGGACTATCATGAC/CGCAATCAGAGCCCTGTAGAA 90/1.93
Cyclophilin EC969926 AT4G34870.1 Peptidyl-prolyl cis-trans isomerase/cyclophilin (CYP1) GGAGCCTGAGCCTACCTTCTC/GTGTTCGGCCAGGTGGTAGA 66/1.86
EF1-α EC959059 AT5G60390.1 Elongation factor 1-alpha (other hits include AT1G07940.2, AT1G07940.1, AT1G07920.1, AT1G07930.1) GAACTGGGTGCTTGATAGGC/AACCAAAATATCCGGAGTAAAAGA 150/1.87
PP2A CB980232 AT3G25800.1 Serine/threonine protein phosphatase 2A (PP2A) 65 KDa regulatory subunit A TCGTGATGCTGCTGCTAACAA/TTGCCCAGTCAGGACCAAAT 62/1.90
SAND CF405409 AT2G28390.1 SAND family protein CAACATCCTTTACCCATTGACAGA/GCATTTGATCCACTTGCAGATAAG 76/1.91
Sucrose transporter EC920891 AT2G02860.1 Sucrose transporter/sucrose-proton symporter GGATAACTTCCCTGCCTCAATGA/TTCTTGTAGCAGCTGAGAGGATCA 67/1.91
TIP41 EC947050 AT4G34270.1 TIP41-like family protein CATGCGAGTGTCCCTCAATCT/TCTCTTGCGTTTCTGGCTTAGA 61/1.92
α-Tubulin EC930869 AT5G19780.1 Tubulin alpha-3/alpha-5 chain (TUA5) (other hits include TUA1-4, TUA6) CAGCCAGATCTTCACGAGCTT/GTTCTCGCGCATTGACCATA 119/1.82
β-Tubulin EC922104 AT1G75780.1 Tubulin beta-1 chain (TUB1) TGAACCACTTGATCTCTGCGACTA/CAGCTTGCGGAGGTCTGAGT 86/1.54
UBC EC922622 AT1G64230.1 Ubiquitin-conjugating enzyme GAGGGTCGTCAGGATTTGGA/GCCCTGCACTTACCATCTTTAAG 75/1.92
UBQ-L40 EC929411 AT3G52590.1 Ubiquitin extension protein 1 (UBQ1)/60S ribosomal protein L40 (RPL40B) CATAACATTTGCGGCAGATCA/TGGTGGTATTATTGAGCCATCCTT 80/1.89
EF1-α (m) CB977561 AT5G60390.1 Elongation factor 1-alpha (other hits include AT1G07940.2, AT1G07940.1, AT1G07920.1, AT1G07930.1, AT5G60390.2) CGCCTGTCAATCTTGGTCAGTAT/AATGGCTATGCCCCTGTTCTG 83/1.70
  CB975242     
  EC958777     
  EC931777     
  EC925368     
GAPDH (m) CB973647 AT1G13440.1 Glyceraldehyde 3-phosphate dehydrogenase, cytosolic. TTCTCGTTGAGGGCTATTCCA/CCACAGACTTCATCGGTGACA 70/1.84
  CB970967     
  CF515110     
  EC930334     
MDH (m) EC921711 AT5G43330.1 Malate dehydrogenase, cytosolic (other hit include AT1G04410.1 MDH cytosolic) CCATGCATCATCACCCACAA/GTCAACCATGCTACTGTCAAAACC 72/1.85
  EC923897     
  EC921960     
  EC919995     
UBQ10 (m) CB915250 AT4G02890.1 Polyubiquitin (UBQ14) (other hits include UBQ4, UBQ10, UBQ11) CAAATGGCTGAGACCCACAA/TATCCCAGTGGTCGGTTGGT 73/1.88
  CB977307     
  1. All grape sequences were named based on similarity to Arabidopsis proteins determined via BLASTX. In most cases, the name indicates only a gene family or subfamily rather than a specific member since partial grape sequences and BLAST searches do not necessarily identify the putative Arabidopsis ortholog. Closest Arabidopsis homologs were identified using TAIR BLAST 2.2.8.
  2. * The PCR efficiency was determined with LinReg software [23].
  3. Terrier et. al. [2].
  4. (m) indicates that the primer pair was designed to target more than one gene family member.