Skip to main content

Table 3 DNA sequence of PCR primers used in the present work

From: Analysis of cDNA libraries from developing seeds of guar (Cyamopsis tetragonoloba(L.) Taub)

Gene Name Forward primer Reverse primer
Actin GGCTGGATTTGCTGGAGATGATGC CAATTTCTCGCTCTGCTGAGGTGG
Galactosyl transferase UG05797 GGGACGAGAAGCGTAAGG CTCCTCCTCAACCCTTCC
Mannan synthase UG07564 CAAGTCACTAGTCCATCCTGC TACAGTTCTATGCTTATGGATAGC
Mannosidase UG00294 GCTATATTCTCCGTGACATCCAG CACAAAGCGCCAAGTTAAACTCG
Mannanase UG00260 GGCTCTTCAACAAGCTTCTAACC GGTCCACTTTGCTTGAGTTTGGC
Conglutin UG00199 CATTACACTCCTACAGAAACGGTGAG AAGGCAACAAAGCACACTCTAAGTGC