Skip to main content

Table 6 Cloning primers and PCR conditions.

From: Assessment of allelic diversity in intron-containing Mal d 1 genes and their association to apple allergenicity

Gene Primersa Pfub Tm/cycles Taq Tm/cycles Reference sequence
Mal d 1.01 F: ATCTCCAACACAATACTCTCAAC
R: AAAGCCACACAACCTTCGAC
58/25 60/2 AY789236
Mal d 1.02 F: CATCCTTGGTAGTTGCTTTC
R: ACCATAGAAACATATTAATTTAGT
52/25 54/2 AY789239
Mal d 1.04 F: CGTAGTTGGACAAGTGTCTTAGT
R: AGGGTAACACACAAATTACATG
58/30 60/2 AY789242
Mal d 1.05 F: AGTTCATCATGGGTGTTTTC
R: GGTAACACACAAATTACAAATATGC
53/30 55/2 AY789245
Mal d 1.06A-C F: CATGGGTGTCCTCACATACGAAAC
R: TTAGTTGTAGGCATCAGGATTG
55/25 57/2 AY789248
Mal d 1.06C F: ATGGGTGTCCTCACATACGAAACT
R: TTAGTTGTAGGCATCAGGATTGGCCACAAGGTG
62/30 64/2 AY789255
  1. aPrimers for Mal d 1.04 and Mal d 1.05 are new, others have been adopted from Gao et al. [15].
  2. b The PCR was performed in two steps starting with Pfu polymerase and finishing with super Taq [15, 22].