Skip to main content

Table 6 Localisation of the genes chosen for partial re-sequencing, specific PCR primers used and size of the gene fragment re-sequenced

From: Construction of nested genetic core collections to optimize the exploitation of natural diversity in Vitis vinifera L. subsp. sativa

DNA fragment (GenbanK) LG located Size Primer forward (5'→3' sequence) Primer reverse (5'→3' sequence)
DFR (X75964) 18 810 nt CAAGCTGCATGGAAGTATGC TTGGGCCATTCCGTTTTATTA
L-DOX (BQ795708) 8 500 nt TTGAGCCCAATCATATTAGTTCC GTGGCATGACCATTCTCCTC
BURP (BQ799859) 3 700 nt CGAAAAGGGACACACAGAG GTTCAGAGTAGGCCTCGGAA
Total   2010 nt