Skip to main content

Table 7 Primers used for qRT-PCR

From: Genome-wide identification and transcriptional analysis of folate metabolism-related genes in maize kernels

Gene abbreviation Forward primer sequences (5′-3′) Reverse primer sequences (5′-3′)
ACTIN GGGATTGCCGATCGTATGAG GAGCCACCGATCCAGACACT
GCH1-1 GGAGGAAAGCGACTACATCGG GAAACAGAGCACCTTGCACTATG
GCH1-2 GCAAAGCGACTGCATCCC CACCCCGCACTATGTCCTTC
FOLB1 GCGGCCTTCAGTTCCACG CCTTTGCAATGCTGTAGATATCGG
FOLB2 CGCCTGGATAGACCTCGC GAGGCTTGCCAACCTTCACT
HPPK/DHPS TCTCATACGCTCAACCATGCTC GGAACAACATGTCTGGAAGCTCT
ADCS CTTGTGAGTCAGATGATAGCCGAG AATCTGTCTTCCGTGATGAGTAGC
ADCL1 GAGCTTGGCATAGGCGAAC CTCCCATACCACCAGGGTG
ADCL2 GTCAGCACCAGGGACATCACAG CCCACAGCAGATCAGACAGCG
ADCL3 n/a n/a
DHFS-1 CTCCGACGACGGGTTTGAC CTCATGATATTGGACAGGAATGCAG
DHFS-2 CGCAAGGCTACAATGTGGG AGAGAGCAGTAAAAACCTCAAAATG
DRTS-1 GAGAAAGTGTTTGTTATAGGAGGCG CTGAGAAGTCAACCGGAGGG
DRTS-2 GTGATAGAGAGCAACATTAGGCATT CGACAACACCACGCCAAAATACC
DRTS-3 CATGTTCGAGCACTGGAGGAGC CATCTCTATCTTCTGGTGGGGGTC
DRTS-4 CAGTGGCTCAACAAATGCAAAG TCCAGTATAGTCAGCATGCATGTC
FPGS-1 GCAGTTGAAAGTGGTTCACGTTG CCATCAAGCCGAAATCGCTC
FPGS-2 ACGTTACCACTCAATCGTACTG GGGAAAACCACTTGCCAC
SHMT1 CGCAAGATACTACGGGGGAAATG TGAGAAAGATGTCCACCGTGAGG
GCSH1 CTATCCGATCCAACCCTTTC CCGTCGTCTTGACCCATT
GCSH2 CGCCTACCTCAGGATCTCCAC GGTCAGTAATCCCCACGGTTG
GCSH3 CGAACAACCCTCGTCCACC CCCATTCATGAGTGTCAGCATAT
GCSH4 AGCGGGAGAGAGAGGAGCG CTGGTCGCCTTCACGCTCTC
GCSP CTCGCTATGCCACAGTATGATC TAACAGGTTGCCCAAGTCGTC
GCST CGGATGCAGGGACAAGGAC CTCAAATCTTCTTTCGTCAGCAAC
FOLD1 GTTGCCTGGAAACTGTTCAGAAG CATTTAAGGGATGGAAACCATC
FOLD2 AACATCGTCGGGCTACCT CTGGCTTGATCCAGTCACCT
FOLD3 CGACTCAGCAACCGTCTCAG CTGAGAATCCTTCCTCGACCC
MTHR1 TCGAGTACTTCCCTCCCAAG CCACACACACCATGTTCTGC
MTHR2 TACAAGGCGAGGGAGGTG CAAGTAATACCAATTTGGCGG
MS1 TACAATCGGTTCGTTCCCAC GATTTCCTCCTTGATGGCAGT
MS2 GACCACCGCCGTTCTACC CGACCTTGCTGATTTCTTCC
MS3 GAGGGTCCGTCGTGAGTAC CCATCCGTTGGCAGTGAAT
PURU CGGGGCAACTAGCCATTTCG GGTAGGACACGAAGCTCGCAATATG
FTHS CTACGACCTCTACGGCAAGTAC GACGGAGGCAAGTGACAAC
5FCL TGTCAGCAGTTGCGAGAAG GTTCCCAGTAGCATCCACAG
5FCLL ACGGTTAGGGAAGGGAGAGG TGTGGCTTTGGGATCGTAGTC