Skip to main content

Table 1 DNA primers used in this study

From: Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing

Primer name Nucleotide sequence (5’ to 3’)
C1-ApaI-F ATTAGGGCCCAGGTAAGCTTCAGG
C1-R ATTGATTTCACCTGTCCAGTTGTAT
C1SP-F GGCATCGGCTAGGGAAATAG
C1SP-R TGCTACTTGGGTGACATTGTTC
F1 GAATTGTCGAGGTCGAAGATC
R1 ATAGTGAAACAGGGGCAATGG
F2 ACGGCGAGTTCTGTTAGGTC
R2 TCATCGGGTTTCGGTGACTC
Hpt-F1 AAAAAGCCTGAACTCACCGCGACGT
Hpt-R1 TACTTCTACACAGCCATCGGTCCA
Hpt-R4 ATGGCCTCCGCGACCGGC
TNos-F TACAAAGTGGTGATAAGGGCG
TNos-R AAACTGAAGGCGGGAAACGAC
Gus-L-F CGCATTACCCTTACGCTGAAGAG
Gus-L-R AGACGCGGTGATACATATCCAGC