Novel and conserved miRNAs in the halophyte Suaeda maritima identified by deep sequencing and computational predictions using the ESTs of two mangrove plants

Gharat, Sachin Ashruba; Shaw, Birendra Prasad

doi:10.1186/s12870-015-0682-3

Table 1 Identification and Characterization of S. maritima miRNAs that are conserved in other plants

From: Novel and conserved miRNAs in the halophyte Suaeda maritima identified by deep sequencing and computational predictions using the ESTs of two mangrove plants

Family	miRNA	Sequence	Other plant species	Validation method	Stress response
miR156/157	sma-miR157a	uugacagaagauagagagcac	aly, gma, ath, lus, ptc, mdm, mes, cme, ppe, mtr, vvi, tcc, rco, bna, stu, cpa, cca, sly, vun, bra, ahy, bol, gra, han	Cloned, Northern, 3’ RACE, 454, MPSS, Illumina	Drought and biotic stress [70], salt stress [60, 71]
miR159	sma-miR159a	uuuggauugaagggagcucua	aly, gma, ath, ptc, mes, cme, nta, ppe, mtr, vvi, rco, bna, csi, cpa, sly, bra, hbr, htu, ahy, pvu	Cloned, Northern, 5’ RACE, 454, MPSS, Illumina	Drought and biotic stress [70], Mechanical stress [72], biotic and drought stress [70, 73]
miR164	sma-miR164a	uggagaagcagggcacgugca	aly, gma, ath, lus, ptc, mdm, mes, cme, nta, ppe, osa, mtr, vvi, tcc, bdi, zma, rco, bna, csi, sbi, cpa, ssl, ghr, tae, ctr, bra	Cloned, Northern, 5’ RACE, 454, MPSS, Illumina	Mechanical stress [72]
miR166	sma-miR166a	ucggaccaggcuucauucccc	aly, gma, lus, mdm, mes, cme, nta, ppe, vvi, tcc, bdi, rco, bna, stu, csi, aqc, cpa, sly, ssl, dpr, ctr, hbr, ssp, hvu, hpe, pvu, hpa	Cloned, Northern, 5’ RACE, 454, MPSS, Illumina	Drought and biotic stress [73], Drought stress [74], dehydration stress [75], cold and dehydration stress [76]
miR169	sma-miR169a	cagccaaggaugacuugccga	aly, gma, ath, lus, ptc, mes, nta, osa, mtr, vvi, tcc, bdi, zma, bna, sbi, sly	Cloned, Northern, 5’ RACE, 454, MPSS, Illumina	Drought stress [74]
miR171	sma-miR171b	ugauugagccgugccaauauc	gma, lus, ptc, mdm, mes, cme, nta, ppe, osa, mtr, vvi, tcc, bdi, zma, rco, stu, sbi, aqc, cpa, sly, tae, htu, lja, crt, hvu, far, pde, hpa	By similarity	Nutrient starvation [77], mechanical stress [72], drought stress [74], dehydration stress [75]
miR396	sma-miR396b	uuccacagcuuucuugaacuu	aly, gma, ath, lus, ptc, mdm, mes, cme, nta, ppe, osa, mtr, tcc, bdi, zma, rco, bna, stu, sbi, aqc, cca, pta, bgy, bcy, ama	Northern, 5’ RACE, 454, MPSS, PCR	Nutrient starvation [77], drought and biotic stress [70], drought stress [74], salt stress [30, 60]

aly A rabidopsis lyrata, gma G lycine max, ath A rabidopsis thaliana, lus L inum usitatissimum, ptc P opulus trichocarpa, mdm M alus domestica, mes M anihot esculenta, cme C ucumis melo, nta N icotiana tabacum, ppe P runus persica, osa O ryza sativa, mtr M edicago truncatula, vvi V itis vinifera, tcc T heobroma cacao, bdi B rachypodium distachyon, zma Z ea mays, rco R icinus communis, bna B rassica napus, stu Solanum tuberosum, csi C itrus sinensis, sbi S orghum bicolor, aqc A quilegia caerulea, cpa C arica papaya, cca C ynara cardunculus, sly S olanum lycopersicum, vun V igna unguiculata, ssl S alvia sclarea, ghr G ossypium hirsutum, tae T riticum aestivum, dpr D igitalis purpurea, aau A cacia auriculiformis, ctr C itrus trifoliate, bra B rassica rapa, hbr H evea brasiliensis, ssp Saccharum ssp., htu H elianthus tuberosus, lja L otus japonicas, ccl C itrus clementine, crt C itrus reticulate, smo S elaginella moellendorffii, ahy A rachis hypogaea, hvu H ordeum vulgare, bol B rassica oleracea, amg A cacia mangium, hpe H elianthus petiolaris, pta P inus taeda, far F estuca arundinacea, pvu P haseolus vulgaris, gra G ossypium raimondii, pde P inus densata, hpa H elianthus paradoxus, bgy B ruguiera gymnorhiza, bcy B ruguiera cylindrical, han H elianthus annuus, har H elianthus argophyllus, ama A vicennia marina

Back to article page

ISSN: 1471-2229

Contact us

General enquiries: journalsubmissions@springernature.com

BMC Plant Biology

Contact us