From: Deep Super-SAGE transcriptomic analysis of cold acclimation in lentil (Lens culinaris Medik.)
TAG number | TAG sequence | Fold change1 | Nucleotide sequence identity between TAG and lentil sequences2 | Lens sequences | Other legume species sequences | UniProt identification and accession number |
---|---|---|---|---|---|---|
AS8 | CATGAGATTGCACTTGAGTAACTTGG ANTISENSE | 7.34 | 25-26 | 64544 647 331115122 | 502080648 2 g104400 | Mediator of RNA polymerase II transcription subunit 15a?? Transcription cofactor, putative, G7IM96_MEDTR?? |
AS27 | CATGAGTTGGCGTCCAATATTTTGAA ANTISENSE | 5.67 | 25-26 | 72001 296 56138 122 331117328 | 086s0008 502127601 | ABC transporter C family member?? |
NAS10a | CATGTTTTTGAATTGTGATTGCTCTC ANTISENSE | 7.28 | 25 | N107087 N6881 331108837 368545933 | 388509589 502117510 571480914 | Haloacid dehalogenase-like hydrolase, A0A072VYK9_MEDTR |
NAT38 | CATGATTTTCCCTCTCAAGACTAAGT ANTISENSE | 5.10 | 25-26 | N11063 68382 215 66867 237 | 552990588 502124263 571537824 | Protein FAM135B-like protein, A0A0B2PEB3_GLYSO |
NAT39 | CATGGTCATAAAGGTTCTGAATAGGG ANTISENSE See AS2 and AT7 | 5.10 | 25-26 | 331108296 268537762 268541446 | 5g097280 502099852 359806052 | Light-harvesting complex I chlorophyll A/B-binding protein, G7KEN2_MEDTR Chlorophyll a/b binding protein 215, CB215_PEA |
N15 = T30 | CATGATGTCGCCGACCGTAACAATAA ANTISENSE | 5.08 | 25-26 | 331109463 87696 239 64868 288 | 1g012710 1g012690 502124985 | Protease inhibitor/seed storage/LTP family protein, G7I725_MEDTR |
A18 = T25 | CATGGTTATAGCCTCCTCCTCCACCA ANTISENSE See A1, A22 and A35 | 5.39 | 26 | 331121144 65367 194 | 5g084570 114415397 502097761 | Cold and drought-regulated protein CORA, G7K7D2_MEDTR Putative glycine-rich protein, Q0E7L3_PEA |
A25 = T26 | CATGATGATATAATCAGTTACCATTG ANTISENSE | 5.01 | 23-26 | 65697 176 331109145 | 2605888 | Dormancy-associated protein, O22612_PEA (glycine-rich protein). |
A35 | CATGGCCAATAGGCCAAGGATGAGGA ANTISENSE See A1, A18 and A22 | 4.04 | 26 | C1949 331121144 331108748 | 5g084570 114415397 | Putative glycine-rich protein, Q0E7L3_PEA Cold and drought-regulated protein CORA, CORA_MEDSA G7K7D2_MEDTR |