Skip to main content

Table 4 Tags related to proline-rich (PR) and transmembrane (TM) sequences and their distribution

From: Deep Super-SAGE transcriptomic analysis of cold acclimation in lentil (Lens culinaris Medik.)

  NAS NAT AS AT Type
CATGATGTTTTTAAGTAAATATGTAA
A2 = T23
  0.25 4.67 106.34 a PR
CATGGGATATATATTCTTGTAATCTT
A5
0.47 1.50 59.73 365.82 PR
CATGCCTTTTGATTTTATTATCAGCAb
A6
0.24 4.49 54.31 679.82 PR
CATGTTGTCCATTGATAAAAGGACTCc
A10
  0.25 2.24 16.72 PR
CATGTTCCCAAACCACCTGTTGCCCC
A14
   0.56 30.76 PR
CATGAATATAAAAAATACTTGAGATG
AT1
    1102.15 PR&TM
CATGAATATAAGAAATACTTGAGATG
S25
45.97 13.46 313.57   PR&TM
CATGTAATAGTATTGTGATTTCTGCT
A21 = S6
0.24 0.25 16.99   TM
CATGTTATGAATGAAAAATTACGTGT
AT9
    59.19 TM
CATGAAGCATTTTTAGAATGTAAAAA
AT18
    30.76 TM
CATGTTTATTATTTTTATAAAATTAT
A17 = T15
  0.50   24.74 TM
CATGCAATAAATCTATAAATTATATC
NAT33
  20.19    TM
CATGGAAGAATGTTTACTTGTTCTTC
NAT42
  15.95    TM
CATGAAGAAAAATGAGACAAGATCTT
S9
24.40   6.16   TM
  1. aNumbers in bold indicate the highest value for each tag, normalized values. Empty cells indicate zero observations
  2. bA6 and A10 identified the same lentil sequence in two points along it sequence
  3. cSee also the transmembrane sequences referred in Table 2