Skip to main content

Table 5 Expression levels of cold-acclimation specific1 and late embryogenesis abundant2 proteins

From: Deep Super-SAGE transcriptomic analysis of cold acclimation in lentil (Lens culinaris Medik.)

Tag name Tag sequence NAS NAT AS AT
T171 CATGATAGCAGCAGCAGTGATAGTGA 0.24 193.67 29.49 1154.99
A301 CATGACTTGTATTTGTCTAAGACTGA 4.03 4.98 37.33 198.29
  1. aNormalized values. Empty cells indicate zero observations