Skip to main content

Table 1 Primers used for the WFZP-A sequencing and genotyping

From: Genes WHEAT FRIZZY PANICLE and SHAM RAMIFICATION 2 independently regulate differentiation of floral meristems in wheat

Primer Name Sequence 5′ – 3’ Location
Amplicon sequencing
 WFZP_2A_F1a CATGGGCAAATCGGTTAATG 5′ region
 WFZP_2A_R1a TGGATGAGATGGCGAGGTAG
 WFZP_F2a TCTTGTCAGTGGCAGGCATC 5′ region
 WFZP_2A_R2a TGGCAGAAGTGAAGTGAGGT
 WFZP_F3a GCTCACAGTCTCAGCAACCA 5’-UTR -CDS
 WFZP_2A_R3a CACTGGGCACCGGCATGGAA
 WFZP_2AD_F4a CAGCCAACCTCACTTCACT CDS
 WFZP_2A_R4a GCTAGGGCACCGAAACAAC
 WFZP_F5a ACGACATGGTCGCCTCGT CDS-3′ region
 WFZP_2A_R5a GGATCGGGGTGGATAGATTG
SSR genotyping
 ssrCS248B13–1Fb CTCCAAGAAGATCGAGGTGAACAT  
 ssrCS248B13-1Rb TTGTTACCCTACCGATGATGTGTG
  1. a[25]
  2. b[31]