Table 1 The diagnostic primers, distinguishing the dominant and recessive alleles of the Ant1 and Ant2 genes
Gene | Chromo-some | Primer pair (5′ → 3′) | Annealing temperature, °C | PCR product length (nt) in Bowman/BW648 | Accessions |
|---|---|---|---|---|---|
Ant1 | 7HS | F: gtttgccaaaggtctatgtga R: atgaaattcaggaaggtcgt | 55 | 223/248 | KP265976–79, barke_contig_1832333, bowman_contig_75050, morex_contig_137164 |
Ant2 | 2HL | F: gccgtgtgtttccttagtt R: cgagccaacaacaagcgagac | 55 | 447/268 | KX035100, barke_contig_2804331, bowman_contig_857662, morex_contig_1573231 |