Skip to main content

Table 1 Specific primer sequences

From: MYB-CC transcription factor, TaMYBsm3, cloned from wheat is involved in drought tolerance

Primer name Upstream primer (5′-3′) Downstream primer (5′-3′)
NP 5’CAATGCCATGGATTTCAGTG 3’ 5′ GCCATCACCGACAACGAGG 3’
5′ GCTCTTTACGTGAAAGATTGTC 3’ 5′ CTTCAGCACACCCTTGGGAG 3’
TaMYBsm3-AFL 5’GCTTCTGGACGAACACGG3’ 5’CACTAGAACTCTACATGGCAAG3’
TaMYBsm3-BFL 5’GCTTCTGGACGAACACGG3’ 5’CACTAGAACTCTACATGGCAAG3’
TaMYBsm3-DFL 5’GACTGGCGGCTGATTTGG3’ 5’CACTAGAACTCTACATGGCAAG3’
DW 5’GAGCAACTAGAGGTAACAGTGT3’ 5’CTGGCCTTCTGTTGTTCTAG3’
TR1 5’CGGGATCCATGAGCACACAGAGTG3’ 5’TGCACTGCAGCTATTCGGTGTCTG3’
TR2 5’CGGGATCCATGAGCACACAGAGTG3’ 5’TGCACTGCAGGAAATCCATGGCATTG3’
TR3 5’CGGGATCCATGAGTGAGCAGCTGGAG3’ 5’TGCACTGCAGCTATTCGGTGTCTG3’
TR4 5’CGGGATCCATGTCACCTAGTCTAGTATC3’ 5’TGCACTGCAGCTTCTTGTTGCCAG3’
TSR 5’GCTCTAGAATGAGCACACAGAGTGTA3’ 5’CGGGATCCCGGTTCACTTTCA AGATC3’
WT 5’AGGATACTTGGCAAACAAACGA3’ 5’CAATGGCTTCTACGAGACCGA3’
WQA 5’ACTAGAGGTGCAAAGGAAATTACAA3’ 5’AAGTTCTGTTCTATTTCGGTGTCG3’
WQB 5’TGAGTTCATCACCATCATCATCG3’ 5’TTTGCCAGAATCAATTCCAGG3’
WQD 5’GAGCAACTAGAGGTGCAAAGGG3’ 5’GTTTTCTCCTCTGGTTTCGGC3’
TaMYBsm3R 5’CGGGATCCGACTGGCGGCTGATTTGG3’ 5’TGCACTGCAGCACTAGAACTCTATGGCAAG3’
DREB2A 5’CTGGAGAATGGTGCGGAAGA3’ 5’CAGATAGCGAATCCTGCTGTTGT3’
P5CS1 5’GCGCATAGTTTCTGATGCAA3’ 5’TGCAACTTCGTGATCCTCTG3’
RD29A 5’ATCACTTGGCTCCACTGTTGTTC3’ 5’ACAAAACACACATAAACATCCAAAGT3’
Actin 5’TCGCTGACCGTATGAGCAAAG3’ 5’TGTGAACGATTCCTGGACCTG3’