Skip to main content

Table 3 Target genes from RNA-seq and corresponding primers for qPCR

From: Integrative omics analysis on phytohormones involved in oil palm seed germination

Name Gene ID Primer sequences (5′-3′) Amplicon length (bp)
ABA XM_010922729.2 F- TGGTGGAATCGTACGTGGTC
R- CACTTGACGATTGTGTCCGC
82
GA XM_010921546.2 F- AGCCAACCCACTAGACCAAA
R- ACAGCCTCCTTCTCCAAGTCT
198
ET JN203269.1 F- TTGACTCAGGCACAACTTGC
R- GCCAGCTACGATTAGTTTCCCT
118
CTK NM_001156290.2 F- GACGTGCCACTTCACAATGG
R- CCCTCACCACCCAAAGGAAT
86
IAA KC146057.1 F- AGGGGCTACGTGCTAGAGAA
R- TTTTAATGGTGGCGCGTGTG
186
JA NM_001055402.1 F- ATAGGGCAGTCGGCCAATAC
R- CGTGGGGGCTGCTTTGC
103