From: A modular steroid-inducible gene expression system for use in rice
lacI wild type binding sites | number of hits in the rice genome (putative promoters) | |||
---|---|---|---|---|
exact matches | 3 mismatches | 4 mismatches | 5 mismatches | |
lacO1 AATTGTGAGCGGATAACAATT | 1 | 4 | 111 (4) | 1144 (43) |
lacO2 AAATGTGAGCGAGTAACAACC | 0 | 6 (1) | 88 (3) | 709 (35) |
lacO3 GGCAGTGAGCGCAACGCAATT | 1 | 3 | 53 (3) | 436 (38) |