Skip to main content

Table 3 qRT-PCR primers for transcript profiling in Ae. tauschii accessions

From: Phenotypic and molecular characterization of Hessian fly resistance in diploid wheat, Aegilops tauschii

Gene Forward Primer Reverse Primer
Ubqa (Ubiquitin) ggtgtctccggtatcctccaa tgctccacaccagcagaagt
Hessian fly-responsive biomarker:
Hfr-1 (Hessian fly-response gene 1) cttaagacctctgctttctctaggtga gatggtgatgcgctctaaacg
Hfr-3 (Hessian fly-response gene 3) gtccttgctgggctgatctc tccggtcctaggccacagta
Mds-1 (Mayetiola destructor susceptibility 1) ccaaaagcagacagcaaccccaacc gtcggcgaaggggtcgaacac
Cer4 (Fatty acyl CoA reductase) ccgattccgcattcaacttt gacaccagggatgtggacctt
Oxidative stress pathway:
Prx (Class III peroxidase) agggcgccttcttcgag aggtccatgttgctcatcttgg
Nox (NADPH-dependent oxidase) atgttcggcaacttggtgact cgtctgctctaagaagaccactttt
Gst (Glutathione S-transferase) gtgccggtgctgatcca ggcgaaagcctcgtcgat
Secondary metabolite biosynthesis:
Pal (Phenylalanine-ammonia lyase) gcgtgaagacagtggctagga gcgtgcgttgtggagatg
4Cl (4-coumarate-CoA ligase) gcgaagcaggtggtgttctac gggatggagctcacgaagaag
Ccr (Cinnamoyl-CoA reductase) gttgggccctctgctacaga caccgagccgtccagatact
HfrDrd (Hessian fly-responsive disease resistance dirigent-like gene) ttgaccagtcccaccgaca attcaaagtgttccgtaggacg
  1. aGene used as endogenous control