Skip to main content

Table 4 Primers used for the construction of fluorescence protein fusion

From: Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

Gene Primer No. Sequence
GFP
OnTI1 1894 AAAAAGCAGGCTTCATGGAGTTCATCAAAGCAAAG
  2129 AGA AAGCTGGGTCAGGAGTACACTTTTTAT
YFP
OnTI1 1894 AAAAAGCAGGCTTCATGGAGTTCATCAAAGCAAAG
  1895 AGAAAGCTGGGTCTTAAGGAGTACACTTTTTATC
OnTI2 1892 AAAAAGCAGGCTTCATGGAGCTCATCAAATCATCA
  1893 AGAAAGCTGGGTCTTAATTACTAGTACATTTATT
OnTI3 2124 AAAAAGCAGGCTTCATGGAGTTCATCAAA
  2125 AGAAAGCTGGGTCTTAAGGAGTACACTGTT
OnExpansin 1898 AAAAAGCAGGCTTCATGACACCATCCCTCTTCCTC
  1899 AGAAAGCTGGGTCTCAAAACTGCGCGCCCTCGAA
OnDRRP 1896 AAAAAGCAGGCTTCATGGCTTCCTTCTCCTTCTCT
  1897 AGAAAGCTGGGTCCTAATTGTTGTTAAAGACAAC