Skip to main content

Table 2 Prediction of conserved miRNA targets and experimental validation by 5′-RACE

From: microRNAs targeting DEAD-box helicases are involved in salinity stress response in rice (Oryza sativa L.)

miRNA miRNA sequence Predicted targets Accession no 5′-RACE validation
osa-MIR414 3′- cugcuacuacuacuccuacu – 5′ ABP LOC_Os06g33520 Yes
   DDX46 LOC_Os08g05810 n.d
   DDX47 LOC_Os03g46610 n.d
   PRP5 LOC_Os08g06344 n.d
   RNAhA LOC_Os01g56190 n.d
   CTD2 LOC_Os02g43460 n.d
osa-MIR408 3′ - cggucccuucuccgucacguc – 5′ DSHCT LOC_Os11g07500 Yes
   MIP1 LOC_Os10g41041 n.d
   Plastocyanin LOC_Os02g43660 Yes [12, 31]
osa-MIR164e 3′ - agugcacgggacgaagaggu – 5′ DBH LOC_Os04g40970 Yes
   NAC LOC_Os06g23650 Yes [32]