Table 1 Primers for quantitative real time PCR (RT-qPCR) and for cloning of cDNA of Hessian fly transcripts from polyamine biosynthesis pathway
From: Hessian fly larval feeding triggers enhanced polyamine levels in susceptible but not resistant wheat
Gene | GenBank | Primer Sequence | Primer Sequence |
|---|---|---|---|
| Â | Accession | (RT-qPCR) | (PCR for cloning) |
ubiquitin | DQ674274 | 5’ cccctgcgaaaattgatga 3’ | - |
(Mdes-ubq) |  | 5’ aaccggactacttgcatcgaa 3’ |  |
Polyamine biosynthesis | Â | Â | Â |
ornithine decarboxylase | KJ136117 | 5’ gaaccaggacgattttatgtagca 3’ | 5’ atgaaaatctacggatcaaataaattgc 3’ |
Mdes-odc |  | 5’ cgaatttcacgtttcgaatgaa 3’ | 5’ ttagttgtcgatcaagctatcggg 3’ |
s-adenosylmethionine | KJ136120 | 5’ accccatcgcggcttt 3’ | 5’ atgaacaaaaacgccgacttgcggaa 3’ |
decarboxylase |  | 5’ ggcccgaccattgtcaaa 3’ | 5’ cgtagccaggaaaacgacaatattgaa 3’ |
Mdes-samdc | Â | Â | Â |
spermidine synthase | KJ136119 | 5’ agtgaagctcatggcaaaacg 3’ | 5’ atggacacaattcgaaatggttggttc 3’ |
Mdes-spds |  | 5’ tcatccttttccgtgcattg 3’ | 5’ cgatgaattaagttgtttagcaattgatc 3’ |
spermine synthase | KJ136118 | 5’ ttttgggaggcggtgatg 3’ | 5’ atgtccgctcaaacaattctattg 3’ |
Mde-spms |  | 5’ ggtcacgaactttggattttcttt 3’ | 5’ tcaacaagaattatcaaatgttatttgat 3’ |