Fig. 1From: A novel miniature transposon-like element discovered in the coding sequence of a gene that encodes for 5-formyltetrahydrofolate in wheatTop: Schematic structure of the TRIDC2AG023940 gene. The gene sequence consists of 7 exons (boxes) and a Fortuna TE between exon 5 and exon 6. Note that the coding sequence (CDS) of the gene ends in exon 7. Forward and reverse primers for ssPCR are indicated by arrows. Bottom: site-specific PCR analysis demonstrating Fortuna insertion in intron 5 of the TRIDC2AG023940 gene in all populations. The insertion is indicated by the lower band (543 bp) and a higher band (850 bp) in two accessions of the Mt. Hermon population (bottom left). M denotes a size marker (the numbers in the left are in bp), while NC denotes a negative control (water was used as template in PCR reaction). Primers (indicated in the top scheme) used for this ssPCR were: Forward = TCTTTGTGTATTCTCTAGCTCTGT and Reverse = ACTCCACCCTTTCTCTTTAGCABack to article page