Skip to main content

Table 2 Oligo sequences used in this study

From: Quick selenium accumulation in the selenium-rich rice and its physiological responses in changing selenium environments

GenePrimer sequences
Actin1 (Os03g0718100)FW: TCCATCTTGGCATCTCTCAG
RV: GTACCCGCATCAGGCATCTG
EF1α(Os03g08010)FW: TTTCACTCTTGGTGTGAAGCAGAT
RV: GACTTCCTTCACGATTTCATCGTAA
OsPT2(Os03g05640)FW: AAACTTCCTCGGTATGCTCATG
RV: ATGTTTATGACATCACGCTTGG
OsNIP2;1(Os02g51110)FW: AACATCCAAGTGTGATAGGACG
RV: ACACAAAGACGTAGCTAGTGAT
OsSultr1;2(Os03g0195500)FW: TCAAAGAAGAACCCGCTAGATT
RV: GCAATTCCAAGGAAGCCTTTAA
CAL1(Os02g0629800)FW: AGTCGCGTGTTCTCCTTTGT
RV: AGTCGCGTGTTCTCCTTTGT