High-throughput diagnostic markers for foliar fungal disease resistance and high oleic acid content in groundnut

Pandey, Manish K.; Gangurde, Sunil S.; Shasidhar, Yaduru; Sharma, Vinay; Kale, Sandip M.; Khan, Aamir W.; Shah, Priya; Joshi, Pushpesh; Bhat, Ramesh S.; Janila, Pasupuleti; Bera, Sandip K.; Varshney, Rajeev K.

doi:10.1186/s12870-024-04987-9

BMC Plant Biology

Table 3 Details of validated KASP assays for resistance to leaf rust and LLS and high oleic acid content tables

From: High-throughput diagnostic markers for foliar fungal disease resistance and high oleic acid content in groundnut

QTLs	KASP ID	SNP	Chromosome	Genomic Position (bp)	Trait	Gene ID identified at the time of analysis	Shitoqui V2 gene ID	Tifrunner V1/V2 gene IDs	Annotation
qLLS-A02.1	snpAH0010	C/A	A02	435,829	LLS	Aradu.0G2IC	AH02G00200	Arahy.B6JPF5	LRR - NB-ARC disease resistance protein
	snpAH0011	C/T	A02	436,779	LLS	Aradu.0G2IC	AH02G00200	Arahy.B6JPF5	LRR - NB-ARC disease resistance protein
	snpAH0120	TACACACACACACACA/TACACACACACACA	A02	260,156	LLS	Aradu.D80L9	AH02G03390	Arahy.LDA2L2	SKP1-like protein
	snpAH0121	G/C	A02	442,214	LLS	Aradu.0G2IC	AH02G00200	Arahy.B6JPF5	LRR - NB-ARC disease resistance protein
qLLS-A02.2	snpAH0004	C/G	A02	1,271,582	LLS	Aradu.2U1V2	AH02G01030	Arahy.KAP8H4	Oxoglutarate (2OG and Fe-II-dependent oxygenase superfamily protein
	snpAH0005	G/C	A02	1,156,975	LLS	Aradu.9HA2U	AH02G00920	Arahy.GIK8C1	unknown protein
qLLS-A02.3	snpAH0014	C/G	A02	1,932,131	LLS	Aradu.KFQ7S	AH02G01460	Arahy.IKT7HX	disease resistance family protein/LRR family protein
qLLS-A03.1	snpAH0015	T/A	A03	133,497,786	Rust	Aradu.6U7NW	AH13G52070	Arahy.JT7ZMS	uncharacterized protein
	snpAH0016	C/T	A03	131,788,843	Rust	Aradu.PNQ8T	AH17G26960	0	Unknown protein
	snpAH0017	A/C	A03	131,739,517	Rust	Aradu.H1HIG	AH03G47990	Arahy.06GG2J	Purple acid phosphatase
	snpAH0018	G/A	A03	131,937,796	Rust	Aradu.14 × 1 M	AH03G48170	Arahy.VTXV28	P-loop containing nucleoside triphosphate hydrolase
	snpAH0020	C/T	A03	132,022,031	Rust	Aradu.AB2YQ	AH13G50920	Arahy.T3TBG0	C2H2-like zinc finger protein
	snpAH0021	C/G	A03	133,527,661	Rust	Aradu.KU7EH	AH13G52090	Arahy.GQD7YX	UDP-Glycosyltransferase superfamily protein
	snpAH0022	T/C	A03	133,780,314	Rust	Aradu.Z87JB	AH13G52390	Arahy.R8KUIR	Disease resistance protein (TIR-NBS-LRR class
	snpAH0024	T/C	A03	134,225,429	Rust	Aradu.Y0P95	AH13G52930	Arahy.3N5Q80	RNA 3-terminal phosphate cyclase-like protein
	snpAH0026	G/C	A03	134,613,173	Rust	Aradu.HH10J	AH13G53880	Arahy.L5GP6Q	Major intrinsic protein (MIP family transporter)
	snpAH0128	C/T	Chr13	142,435,734	LLS	AH13G52890	AH13G51110	Arahy.QFR843	Receptor like protein 29
	snpAH0129	AG/A	Chr13	143,296,024	LLS	AH13G53530	0	0	protein coding
	snpAH0130	C/G	Chr13	143,975,755	LLS	AH13G54110	AH13G52470	Arahy.AI5VH5	Ubiquitin-associated (UBA/protein)
	snpAH0132	T/TAA	Chr13	141,981,452	LLS + Rust	AH13G52650	AH13G50800	Arahy.AL67ST	Probable serine/threonine-protein kinase
	snpAH0133	TGTGCAGCATCCTAAAGAATTCAGGC/T	Chr13	141,990,549	LLS + Rust	AH13G52670	AH13G50820	Arahy.0A9D4I	Kinesin-like protein NACK1
	snpAH0134	CTT/C	Chr13	142,829,832	LLS + Rust	AH13G53120	AH03G48830	Arahy.C3CR7W	Serine/threonine protein phosphatase
	snpAH0135	T/G	Chr13	143,462,288	LLS + Rust	AH13G53680	AH13G52000	Arahy.VTBJ7F	Pentatricopeptide repeat-containing protein
	snpAH0136	C/T	Chr13	143,504,769	LLS + Rust	AH13G53720	AH13G52030	Arahy.SAUI5N	Pentatricopeptide repeat (PPR superfamily protein)
	snpAH0137	C/G	Chr13	143,852,868	LLS + Rust	AH13G54010	AH13G55880	Arahy.F01FM8	Disease resistance protein (TIR-NBS-LRR class
	snpAH0138	T/G	Chr13	143,922,005	LLS + Rust	AH13G54070	AH13G52410	Arahy.ZGTC82	Histidine kinase
	snpAH0140	G/T	Chr13	144,783,964	LLS + Rust	AH13G54550	AH13G53400	Arahy.G6JZIF	CBL-interacting serine/threonine-protein kinase 12
	snpAH0141	A/G	Chr13	144,789,658	LLS + Rust	AH13G54850	AH13G53840	Arahy.JR5BIL	MACPF domain-containing protein CAD1
qRust-A02.1	snpAH0003	A/C	A02	768,480	LLS	Aradu.WTH25	AH02G00490	Arahy.02:67ZQRX	unknown protein
	snpAH0149	A/AT	Chr13	142,468,300	Rust	AH13G52920	AH13G51140	Arahy.JF9204	Transcription factor TCP2
qRust-A03.1	snpAH0150	CT/T	Chr13	142,583,511	Rust	AH13G52970	AH13G51650	Arahy.3VLA0M	RING/U-box superfamily protein
	snpAH0151	G/GA	Chr13	142,719,262	Rust	AH13G53060	AH13G51330	Arahy.GHW83A	Topless-related protein 1
	snpAH0152	A/AGAGTAACC	Chr13	143,050,728	Rust	AH13G53300	AH13G13480	Arahy.QP8I27	Protein kinase superfamily protein
	snpAH0153	AGT/A	Chr13	143,320,048	Rust	AH13G53550	AH13G51840	Arahy.8GYA0C	F-box only protein 6
	snpAH0154	T/TAG	Chr13	143,411,025	Rust	AH13G53630	AH13G51920	Arahy.H5PMU0	MACPF domain-containing protein At1g14780
	snpAH0155	TTTC/T	Chr13	143,607,528	Rust	AH13G53800	AH13G52160	Arahy.BKZ08E	Leucine-rich repeat protein kinase family protein
	snpAH0156	G/GTGAAAAC	Chr13	144,046,233	Rust	AH13G54190	AH13G13290	Arahy.909AJ0	Serine/threonine-protein phosphatase
	snpAH0159	GA/G	Chr13	144,452,692	Rust	AH13G54550	AH13G53400	Arahy.G6JZIF	CBL-interacting serine/threonine-protein kinase 12
	snpAH0160	C/CTATA	Chr13	144,798,806	Rust	AH13G54850	AH13G53840	Arahy.JR5BIL	MACPF domain-containing protein CAD1
qOLE-Ah09.1	snpAH0116	A/G	Ah09	1,224,425	HOA	FAD2A	AH09G29670		Fatty acid desaturase from A subgenome
qOLE-Ah19.1	snpAH0002	A/-:-	Ah19	B-genome	HOA	FAD2B	AH19G38370		Fatty acid desaturase from B subgenome

Back to article page

ISSN: 1471-2229

Contact us

General enquiries: journalsubmissions@springernature.com